
It must have felt great getting Apple to hand over $100 million just like that. So nice is the feeling that Creative is already having plans to point their Death Star on the smaller patent infringers.
President of Creative, Craig McHugh, said, “There many MP3 player makers in the US market that are currently using the Zen technology, and there are also several cellphones that are music-enabled that are using the Zen patent.” “We are also ready to take the necessary steps to protect our intellectual property”, he added.
Of course, it’s a no-brainer to take advantage of the situation and reap in the rewards for being the first to be granted the patent. But ridiculous or not, what’s your take?


August 31st, 2006 at 10:08 pm
This is not why patents were created. This type of crap stifles invention.
I think I’ll go out and patent my invention for my “hand-held electronic device that manipulates electricity to entertain the senses of living beings”
I don’t have to make anything, just file the patent. And then sit back and collect the lawsuit money.
Maybe next week I’ll pick some DNA sequence at random, something like ACTGGGTTAACACGATTCAAG, and patent that, maybe I’ll get lucky and it will be something important, then I can choose whether or not to let people benefit from it. After paying me of course.
September 2nd, 2006 at 5:42 am
I wouldn’t be surprised if companies did this intentionally. They see other companies using some part of the technology they developed, but instead of stopping it before it hits the shelves, wait for it to sell big time, makes tons of money, then sue. This way the company they sue can pay them more and suffer greater. It isn’t a matter of intellectual property, but of monetary property.